Journal: Cell & bioscience

Article Title: Impaired mitophagy induces antimicrobial responses in macrophages infected with Mycobacterium tuberculosis.

doi: 10.1186/s13578-023-01107-2

Figure Lengend Snippet: Fig. 1 Mtb infection induces BNIP3 expression in macrophages. A, B Bone marrow-derived macrophages (BMDMs) were infected with Mtb at a multiplicity of infection (MOI) of 1 for 24 and 48 h. A Bnip3 mRNA was analyzed using quantitative real-time PCR. B Levels of BNIP3 at 24 and 48 h post infection were evaluated using western blotting. C BMDMs were infected with Mtb (MOI = 1 or 5) for 24 and 48 h. D BMDMs were infected with live or heat-killed (HK) Mtb (MOI = 1) for 24 and 48 h. E BMDMs were treated with ESAT-6 (10 μg/ml) or Mtb (MOI = 1) for 24 and 48 h, and expression of BNIP3 was evaluated using western blotting. BMDMs were treated with CoCl2 (200 μM) for 24 h and used as a positive control. β-actin was used as a loading control. Data are representatives from at least three independent experiments (mean ± SD of n = 4 in A); *p < 0.05

Article Snippet: Silencing of Bnip3, PINK1, FUNDC1, Parkin, BNIP3L/ NIX, and ATG5 was performed using siRNAs (100 nM) targeting mouse Bnip3 (Bioneer), PINK1, FUNDC1, Parkin, BNIP3L/NIX, and ATG5 mRNA sequences (Santa Cruz Biotechnology) and negative control siRNAs (Bioneer).

Techniques: Infection, Expressing, Derivative Assay, Real-time Polymerase Chain Reaction, Western Blot, Positive Control, Control

Journal: Cell & bioscience

Article Title: Impaired mitophagy induces antimicrobial responses in macrophages infected with Mycobacterium tuberculosis.

doi: 10.1186/s13578-023-01107-2

Figure Lengend Snippet: Fig. 7 The autophagy-related gene ATG5 controls mitophagy. A RAW 264.7 cells were infected with Mtb (MOI = 1) for 24 and 48 h. B–H WT and BNIP3-KO RAW 264.7 cells were transfected with siRNA and then infected with Mtb (MOI = 1) for 48 h. B Mitophagy was measured in RAW 264.7 cells using a mitophagy detection kit (n = 4 per group). C MMP was measured in RAW 264.7 cells using JC-1 staining. Fluorescent intensity of JC-1 was detected at excitation wavelength 488 nm and emission wavelength 530 nm using flow cytometry (n = 4 per group). D WT and BNIP3-KO RAW 264.7 cells were incubated with MitoSOX Red to measure mROS levels. The mROS levels were analyzed using flow cytometry (n = 4 per group). E The analysis of proinflammatory cytokine levels was performed in macrophages at 48 h post infection (n = 6 per group). F Intracellular survival was assayed by enumerating the CFU (n = 9 per group). G WT and BNIP3-KO RAW 264.7 cells were transfected with siRNA and then infected with Mtb (MOI = 1) for 48 h, stained with LC3 (green), Tom20 (red), and DAPI (blue), and visualized using confocal microscopy. H Quantification data in the Fig. 7G. Quantification data of LC3 recruitment to mitochondria were collected from 50 to 60 cells from at four independent experiments. The data are presented as means ± SD of at least three independent experiments; *p < 0.05, **p < 0.01 ***p < 0.001

Article Snippet: Silencing of Bnip3, PINK1, FUNDC1, Parkin, BNIP3L/ NIX, and ATG5 was performed using siRNAs (100 nM) targeting mouse Bnip3 (Bioneer), PINK1, FUNDC1, Parkin, BNIP3L/NIX, and ATG5 mRNA sequences (Santa Cruz Biotechnology) and negative control siRNAs (Bioneer).

Techniques: Infection, Transfection, Staining, Flow Cytometry, Incubation, Confocal Microscopy

Journal: Autophagy

Article Title: Evidence of an unprecedented cytoplasmic function of DDX11, the Warsaw breakage syndrome DNA helicase, in regulating autophagy

doi: 10.1080/15548627.2025.2507617

Figure Lengend Snippet: Autophagy is impaired in WABS patient and DDX11 KO RPE-1 cells. (A) Fibroblasts from three different WABS patients and from a healthy donor (HF1) were left in full medium or serum starved for 16 h. LC3-II level was assessed by western blot analysis. TUBA/tubulin was used as a loading control. (B) Graphs show the quantifications of LC3-II:TUBA. (C,D) fibroblasts from three different WABS patients and from a healthy donor (HF1) were treated with BAF A 1 for 16 h. LC3-II level was assessed by western blot analysis. TUBA was used as loading control. Graphs show the quantifications of LC3-II:TUBA. (E) RNA-seq analysis shows no difference in transcripts per kilobase million/TPM of autophagy genes ( ATG16L1 , ATG5 , ATG12 , BECN1 , SQSTM1 ) between control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells. (F) Western blot analysis revealed no difference in the expression level of the indicated autophagy proteins between control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells. TUBA was used as loading control. (G,H) control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells were grown in full-medium (FM) or serum starved for 16 h (NO FBS). LC3-II was analyzed by western blot. TUBA was used as loading control. Graphs show the quantifications of LC3-II:TUBA. (I,J) Control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells were treated with DMSO or BAF A 1 for 6 h. LC3-II level was analyzed by western blot. TUBA was used as loading control. Graphs show the quantifications of LC3-II:TUBA. (K–M) DDX11 KO (KO) RPE-1 cells were transfected with a vector expressing DDX11-Flag wild-type protein (WT) or the DDX11-Flag K50R helicase-dead mutant (K50R) to perform rescue experiments. After 24 h, control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO (KO + WT and KO + K50R) RPE-1 cells were treated with DMSO or BAF A 1 for 6 h. LC3 level (LC3-I and LC3-II) was analyzed by western blot. Graphs show the quantifications of LC3-II:TUBA. (N) Control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells were transfected with a vector expressing EGFP-HTT-74Q for 48 h to assess HTT mutant protein clearance. (O) Graph shows increased percentage of HTT-positive cells in the DDX11 KO RPE-1 line. Number of cells counted n = 50 in triplicates. Scale bar: 10 µm.

Article Snippet: The following antibodies were used: mouse monoclonal anti DDX11 (Santa Cruz Biotechnology, sc271711); mouse monoclonal anti-Flag antibody (Merck, F1804); rabbit polyclonal anti-LC3 (Novus Biologicals, NB100–2220); mouse monoclonal anti-LAMP1 (Cell Signaling Technology, 15665); rabbit polyclonal anti-SQSTM1 (MBL International, PM045); mouse monoclonal anti-TUBA/α-tubulin antibody (Merck, T6199); rabbit polyclonal anti-ATG16L1 antibody (MBL Life Sciences, PM040); rabbit monoclonal anti-ATG5 antibody (Cell Signaling Technology, 129945); rabbit polyclonal anti-BECN1/BECLIN1 antibody (Cell Signaling Technology, 3738S); rabbit polyclonal anti-AKT antibody (Cell Signaling Technology, 9272S); rabbit polyclonal anti-phospho-AKT (Ser473) antibody (Cell Signaling Technology, 9271 L); rabbit polyclonal anti-BRIP1/FANCJ antibody (Novus Biologicals, NBP1–31883); mouse monoclonal anti-histone H3 antibody (Abcam, ab24834); rabbit monoclonal anti-GFP antibody (Cell Signaling Technology, 2956); mouse and rabbit HRP-conjugated secondary antibody (Merck, A9044 and 12–348, respectively); Alexa Fluor 488 anti-rabbit antibody, Alexa Fluor 555 anti-mouse antibody and Alexa Fluor 633 anti-mouse antibody (Thermo Fisher Scientific, A-11008, A-21137, A-21146, respectively).

Techniques: Western Blot, Control, RNA Sequencing, Expressing, Transfection, Plasmid Preparation, Mutagenesis

Journal: Autophagy

Article Title: Evidence of an unprecedented cytoplasmic function of DDX11, the Warsaw breakage syndrome DNA helicase, in regulating autophagy

doi: 10.1080/15548627.2025.2507617

Figure Lengend Snippet: DDX11 regulates ATG16L1 localization. (A,B) Control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO ( DDX11 KO + WT DDX11 ) RPE-1 cells were transfected with ATG16L1-GFP for 24 h. Confocal imaging shows accumulation of ATG16L1 in the perinuclear area that was reverted by re-expressing the DDX11-Flag wild-type protein. Total cells analyzed: n = 50 per experiment, performed in triplicates. Scale bar: 10 µm. (C) Co-immunoprecipitation experiment using an anti-ATG16 antibody in control (CTRL) and DDX11 KO RPE-1 cells. Western blot analysis shows co-immunoprecipitation of ATG5-ATG12 in both control and DDX11 KO ( DDX11 KO) RPE-1 cells indicating that, in the absence of DDX11, the ATG12–ATG5-ATG16L1 complex formation is not affected. Asterisks denote the IgG heavy chains. (D) Control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO ( DDX11 KO + WT DDX11 ) RPE-1 cells were transfected with a vector expressing GFP-ATG16L1 for 48 h. Co-immunoprecipitation experiment was performed using anti-GFP antibody conjugated beads. The indicated proteins were detected by western blot of the pulled-down sample using specific antibodies. (E) Control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO ( DDX11 KO + WT DDX11 ) RPE-1 cells were transfected with GFP-ATG16L1 and mCherry-LC3 for 24 h. Then, cells were processed as described for panel A. Confocal imaging reveals that ATG16L1 and LC3 do not colocalize in DDX11 KO cells. This phenotype is reversed by re-expressing the DDX11-Flag wild-type protein. Scale bar: 10 µm.

Article Snippet: The following antibodies were used: mouse monoclonal anti DDX11 (Santa Cruz Biotechnology, sc271711); mouse monoclonal anti-Flag antibody (Merck, F1804); rabbit polyclonal anti-LC3 (Novus Biologicals, NB100–2220); mouse monoclonal anti-LAMP1 (Cell Signaling Technology, 15665); rabbit polyclonal anti-SQSTM1 (MBL International, PM045); mouse monoclonal anti-TUBA/α-tubulin antibody (Merck, T6199); rabbit polyclonal anti-ATG16L1 antibody (MBL Life Sciences, PM040); rabbit monoclonal anti-ATG5 antibody (Cell Signaling Technology, 129945); rabbit polyclonal anti-BECN1/BECLIN1 antibody (Cell Signaling Technology, 3738S); rabbit polyclonal anti-AKT antibody (Cell Signaling Technology, 9272S); rabbit polyclonal anti-phospho-AKT (Ser473) antibody (Cell Signaling Technology, 9271 L); rabbit polyclonal anti-BRIP1/FANCJ antibody (Novus Biologicals, NBP1–31883); mouse monoclonal anti-histone H3 antibody (Abcam, ab24834); rabbit monoclonal anti-GFP antibody (Cell Signaling Technology, 2956); mouse and rabbit HRP-conjugated secondary antibody (Merck, A9044 and 12–348, respectively); Alexa Fluor 488 anti-rabbit antibody, Alexa Fluor 555 anti-mouse antibody and Alexa Fluor 633 anti-mouse antibody (Thermo Fisher Scientific, A-11008, A-21137, A-21146, respectively).

Techniques: Control, Transfection, Imaging, Expressing, Immunoprecipitation, Western Blot, Plasmid Preparation

Journal: Oncotarget

Article Title: Fasting inhibits colorectal cancer growth by reducing M2 polarization of tumor-associated macrophages.

doi: 10.18632/oncotarget.20301

Figure Lengend Snippet: Figure 3: Fasting induces cancer cell autophagy, downregulates CD73 expression of cancer cells and suppresses adenosine generation in vitro. (A) The mRNA expression of Atg5 was examined by qPCR in normal or fasting medium for 24 h or 48 h. **P<0.01. (B) The expression of Atg5 was tested by Western blotting. (C) The expression of LC3I/II was tested by Western blotting. (D) The mRNA expression of CD73 was tested by qPCR. *P<0.05. (E) The expression of CD73 was determined by Western blotting. (F) The levels of adenosine were tested by ELISA. *P<0.05, **P<0.01.

Article Snippet: Atg5, CD73 and STAT3 knockdown in CT26 and RAW264.7 cells The small hairpin RNA (shRNA) targeting mouse Atg5 (shAtg5, CACCGGACTGCAGAATGACAGATTT CAAGAGAATCTGTCATTCTGCAGTCCTTTTTTG),C D73(shCD73,CACCGCAGCCTGAAGTAGATAAACT TTCAAGAGAAGTTTATCTACTTCAGGCTGCTTTTT TG),STAT3(shSTAT3,CACCGGAGCAGCATCTTCAG GATGTTTCAAGAGAACATCCTGAAGATGCTGCTC CTTTTTTG) and a scrambled shRNA used as negative control (NC, Addgene) were synthesized and cloned into the pLenti-C-Myc-DDK (Origene, China) to generate the lentirival expression vectors.

Techniques: Expressing, In Vitro, Western Blot, Enzyme-linked Immunosorbent Assay

Journal: Oncotarget

Article Title: Fasting inhibits colorectal cancer growth by reducing M2 polarization of tumor-associated macrophages.

doi: 10.18632/oncotarget.20301

Figure Lengend Snippet: Figure 4: Knockdown of Atg5 in cancer cells enhances adenosine’s effect on macrophages and tumor growth in coculture condition. (A-F) CT26 cells were stably transfected with shAtg5 (Atg5 KD) or shNC (NC). (A-B) The CT26 expression of CD73 was detected by qPCR in fasting medium. *P<0.05. (C) The levels of extracellular adenosine were tested by ELISA. *P<0.05. (D-E) The levels of M2 macropages were detected by FCM (flow cytometry). *P<0.05. (F) The proliferation of CT26 cells was tested by CCK8. *P<0.05, **P<0.01.

Article Snippet: Atg5, CD73 and STAT3 knockdown in CT26 and RAW264.7 cells The small hairpin RNA (shRNA) targeting mouse Atg5 (shAtg5, CACCGGACTGCAGAATGACAGATTT CAAGAGAATCTGTCATTCTGCAGTCCTTTTTTG),C D73(shCD73,CACCGCAGCCTGAAGTAGATAAACT TTCAAGAGAAGTTTATCTACTTCAGGCTGCTTTTT TG),STAT3(shSTAT3,CACCGGAGCAGCATCTTCAG GATGTTTCAAGAGAACATCCTGAAGATGCTGCTC CTTTTTTG) and a scrambled shRNA used as negative control (NC, Addgene) were synthesized and cloned into the pLenti-C-Myc-DDK (Origene, China) to generate the lentirival expression vectors.

Techniques: Knockdown, Stable Transfection, Transfection, Expressing, Enzyme-linked Immunosorbent Assay, Flow Cytometry

Journal: Oncotarget

Article Title: Fasting inhibits colorectal cancer growth by reducing M2 polarization of tumor-associated macrophages.

doi: 10.18632/oncotarget.20301

Figure Lengend Snippet: Figure 7: Fasting suppresses M2 polarization of macrophages through inactivating JAK1/STAT3 signal pathway in coculture condition. (C-E) Raw264.7 cells were stably transfected with shSTAT3 (STAT3 KD) or shNC (NC). (A) The expression of JAK1/STAT3 signal pathway of RAW264.7 cells was determined by Western blotting. (B) The expression of JAK1/STAT3 signal pathway of RAW264.7 cells was determined by Western blotting when Atg5 or CD73 of CT26 cells were knocked down. (C-D) The levels of M2 macropages were detected by FCM (flow cytometry). **P<0.01. (E) The proliferation of CT26 cells was tested by CCK8. *P<0.05, **P<0.01.

Article Snippet: Atg5, CD73 and STAT3 knockdown in CT26 and RAW264.7 cells The small hairpin RNA (shRNA) targeting mouse Atg5 (shAtg5, CACCGGACTGCAGAATGACAGATTT CAAGAGAATCTGTCATTCTGCAGTCCTTTTTTG),C D73(shCD73,CACCGCAGCCTGAAGTAGATAAACT TTCAAGAGAAGTTTATCTACTTCAGGCTGCTTTTT TG),STAT3(shSTAT3,CACCGGAGCAGCATCTTCAG GATGTTTCAAGAGAACATCCTGAAGATGCTGCTC CTTTTTTG) and a scrambled shRNA used as negative control (NC, Addgene) were synthesized and cloned into the pLenti-C-Myc-DDK (Origene, China) to generate the lentirival expression vectors.

Techniques: Stable Transfection, Transfection, Expressing, Western Blot, Flow Cytometry

Journal: Oncotarget

Article Title: Fasting inhibits colorectal cancer growth by reducing M2 polarization of tumor-associated macrophages.

doi: 10.18632/oncotarget.20301

Figure Lengend Snippet: Figure 8: Proposed model of the effect of fasting on STAT3 pathway during polarization of tumor-associated macrophages. Fasting induces expression of autophagy-related Atg5 and LC3II/I of colon cancer, then downregulates the level of adenosine by suppressing CD73, which modulates M2 polarization of TAMs through inactivating JAK1/STAT3, and eventually inhibits tumor growth.

Article Snippet: Atg5, CD73 and STAT3 knockdown in CT26 and RAW264.7 cells The small hairpin RNA (shRNA) targeting mouse Atg5 (shAtg5, CACCGGACTGCAGAATGACAGATTT CAAGAGAATCTGTCATTCTGCAGTCCTTTTTTG),C D73(shCD73,CACCGCAGCCTGAAGTAGATAAACT TTCAAGAGAAGTTTATCTACTTCAGGCTGCTTTTT TG),STAT3(shSTAT3,CACCGGAGCAGCATCTTCAG GATGTTTCAAGAGAACATCCTGAAGATGCTGCTC CTTTTTTG) and a scrambled shRNA used as negative control (NC, Addgene) were synthesized and cloned into the pLenti-C-Myc-DDK (Origene, China) to generate the lentirival expression vectors.

Techniques: Expressing

Journal: Autophagy

Article Title: Evidence of an unprecedented cytoplasmic function of DDX11, the Warsaw breakage syndrome DNA helicase, in regulating autophagy

doi: 10.1080/15548627.2025.2507617

Figure Lengend Snippet: Autophagy is impaired in WABS patient and DDX11 KO RPE-1 cells. (A) Fibroblasts from three different WABS patients and from a healthy donor (HF1) were left in full medium or serum starved for 16 h. LC3-II level was assessed by western blot analysis. TUBA/tubulin was used as a loading control. (B) Graphs show the quantifications of LC3-II:TUBA. (C,D) fibroblasts from three different WABS patients and from a healthy donor (HF1) were treated with BAF A 1 for 16 h. LC3-II level was assessed by western blot analysis. TUBA was used as loading control. Graphs show the quantifications of LC3-II:TUBA. (E) RNA-seq analysis shows no difference in transcripts per kilobase million/TPM of autophagy genes ( ATG16L1 , ATG5 , ATG12 , BECN1 , SQSTM1 ) between control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells. (F) Western blot analysis revealed no difference in the expression level of the indicated autophagy proteins between control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells. TUBA was used as loading control. (G,H) control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells were grown in full-medium (FM) or serum starved for 16 h (NO FBS). LC3-II was analyzed by western blot. TUBA was used as loading control. Graphs show the quantifications of LC3-II:TUBA. (I,J) Control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells were treated with DMSO or BAF A 1 for 6 h. LC3-II level was analyzed by western blot. TUBA was used as loading control. Graphs show the quantifications of LC3-II:TUBA. (K–M) DDX11 KO (KO) RPE-1 cells were transfected with a vector expressing DDX11-Flag wild-type protein (WT) or the DDX11-Flag K50R helicase-dead mutant (K50R) to perform rescue experiments. After 24 h, control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO (KO + WT and KO + K50R) RPE-1 cells were treated with DMSO or BAF A 1 for 6 h. LC3 level (LC3-I and LC3-II) was analyzed by western blot. Graphs show the quantifications of LC3-II:TUBA. (N) Control (CTRL) and DDX11 KO ( DDX11 KO) RPE-1 cells were transfected with a vector expressing EGFP-HTT-74Q for 48 h to assess HTT mutant protein clearance. (O) Graph shows increased percentage of HTT-positive cells in the DDX11 KO RPE-1 line. Number of cells counted n = 50 in triplicates. Scale bar: 10 µm.

Article Snippet: The following antibodies were used: mouse monoclonal anti DDX11 (Santa Cruz Biotechnology, sc271711); mouse monoclonal anti-Flag antibody (Merck, F1804); rabbit polyclonal anti-LC3 (Novus Biologicals, NB100–2220); mouse monoclonal anti-LAMP1 (Cell Signaling Technology, 15665); rabbit polyclonal anti-SQSTM1 (MBL International, PM045); mouse monoclonal anti-TUBA/α-tubulin antibody (Merck, T6199); rabbit polyclonal anti-ATG16L1 antibody (MBL Life Sciences, PM040); rabbit monoclonal anti-ATG5 antibody (Cell Signaling Technology, 129945); rabbit polyclonal anti-BECN1/BECLIN1 antibody (Cell Signaling Technology, 3738S); rabbit polyclonal anti-AKT antibody (Cell Signaling Technology, 9272S); rabbit polyclonal anti-phospho-AKT (Ser473) antibody (Cell Signaling Technology, 9271 L); rabbit polyclonal anti-BRIP1/FANCJ antibody (Novus Biologicals, NBP1–31883); mouse monoclonal anti-histone H3 antibody (Abcam, ab24834); rabbit monoclonal anti-GFP antibody (Cell Signaling Technology, 2956); mouse and rabbit HRP-conjugated secondary antibody (Merck, A9044 and 12–348, respectively); Alexa Fluor 488 anti-rabbit antibody, Alexa Fluor 555 anti-mouse antibody and Alexa Fluor 633 anti-mouse antibody (Thermo Fisher Scientific, A-11008, A-21137, A-21146, respectively).

Techniques: Western Blot, Control, RNA Sequencing, Expressing, Transfection, Plasmid Preparation, Mutagenesis

Journal: Autophagy

Article Title: Evidence of an unprecedented cytoplasmic function of DDX11, the Warsaw breakage syndrome DNA helicase, in regulating autophagy

doi: 10.1080/15548627.2025.2507617

Figure Lengend Snippet: DDX11 regulates ATG16L1 localization. (A,B) Control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO ( DDX11 KO + WT DDX11 ) RPE-1 cells were transfected with ATG16L1-GFP for 24 h. Confocal imaging shows accumulation of ATG16L1 in the perinuclear area that was reverted by re-expressing the DDX11-Flag wild-type protein. Total cells analyzed: n = 50 per experiment, performed in triplicates. Scale bar: 10 µm. (C) Co-immunoprecipitation experiment using an anti-ATG16 antibody in control (CTRL) and DDX11 KO RPE-1 cells. Western blot analysis shows co-immunoprecipitation of ATG5-ATG12 in both control and DDX11 KO ( DDX11 KO) RPE-1 cells indicating that, in the absence of DDX11, the ATG12–ATG5-ATG16L1 complex formation is not affected. Asterisks denote the IgG heavy chains. (D) Control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO ( DDX11 KO + WT DDX11 ) RPE-1 cells were transfected with a vector expressing GFP-ATG16L1 for 48 h. Co-immunoprecipitation experiment was performed using anti-GFP antibody conjugated beads. The indicated proteins were detected by western blot of the pulled-down sample using specific antibodies. (E) Control (CTRL), DDX11 KO ( DDX11 KO) and DDX11-complemented DDX11 KO ( DDX11 KO + WT DDX11 ) RPE-1 cells were transfected with GFP-ATG16L1 and mCherry-LC3 for 24 h. Then, cells were processed as described for panel A. Confocal imaging reveals that ATG16L1 and LC3 do not colocalize in DDX11 KO cells. This phenotype is reversed by re-expressing the DDX11-Flag wild-type protein. Scale bar: 10 µm.

Article Snippet: The following antibodies were used: mouse monoclonal anti DDX11 (Santa Cruz Biotechnology, sc271711); mouse monoclonal anti-Flag antibody (Merck, F1804); rabbit polyclonal anti-LC3 (Novus Biologicals, NB100–2220); mouse monoclonal anti-LAMP1 (Cell Signaling Technology, 15665); rabbit polyclonal anti-SQSTM1 (MBL International, PM045); mouse monoclonal anti-TUBA/α-tubulin antibody (Merck, T6199); rabbit polyclonal anti-ATG16L1 antibody (MBL Life Sciences, PM040); rabbit monoclonal anti-ATG5 antibody (Cell Signaling Technology, 129945); rabbit polyclonal anti-BECN1/BECLIN1 antibody (Cell Signaling Technology, 3738S); rabbit polyclonal anti-AKT antibody (Cell Signaling Technology, 9272S); rabbit polyclonal anti-phospho-AKT (Ser473) antibody (Cell Signaling Technology, 9271 L); rabbit polyclonal anti-BRIP1/FANCJ antibody (Novus Biologicals, NBP1–31883); mouse monoclonal anti-histone H3 antibody (Abcam, ab24834); rabbit monoclonal anti-GFP antibody (Cell Signaling Technology, 2956); mouse and rabbit HRP-conjugated secondary antibody (Merck, A9044 and 12–348, respectively); Alexa Fluor 488 anti-rabbit antibody, Alexa Fluor 555 anti-mouse antibody and Alexa Fluor 633 anti-mouse antibody (Thermo Fisher Scientific, A-11008, A-21137, A-21146, respectively).

Techniques: Control, Transfection, Imaging, Expressing, Immunoprecipitation, Western Blot, Plasmid Preparation

Journal: Microbiology Spectrum

Article Title: SARS-CoV-2 Harnesses Host Translational Shutoff and Autophagy To Optimize Virus Yields: the Role of the Envelope (E) Protein

doi: 10.1128/spectrum.03707-22

Figure Lengend Snippet: SARS-CoV-2 E expression causes LC3 lipidation, reduction in p62/SQSTM1 levels, and increased eIF-2α phosphorylation. (A) HEK-293 cells were either left untransfected, transfected with a control pUC19 plasmid, or an E-HA expressing plasmid. The cells were harvested at 24 and 48 h posttransfection and equal amounts of proteins were analyzed for LC3lipidation and E expression. The ratio of LC3-II/LC3-I is shown below. (B) Transfections were as in panel A. Equal amounts of proteins were analyzed for p62/SQSTM1, Optineurin and ATG5. (C) HEK-293 cells were transfected with an E-HA expressing plasmid or infected with a HSV-1 Δγ 1 34.5 virus (5 PFU/cell). The cells were harvested at 48 h posttransfection or at 14 h postinfection. Equal amounts of proteins were analyzed for p-eIF-2α. (D) Caco-2 cells were infected with SARS-CoV-2 (2 PFU/cell). The cells were harvested at 48 h and at 72 h postinfection and equal amounts of proteins were analyzed for p-eIF-2α and total eIF-2α. Spike served as a control for the infection. B-actin served as a loading control in panels A-D.

Article Snippet: The mouse monoclonal antibodies to HA-tag (Santa Cruz), GFP (Santa Cruz), ATG5 (Santa Cruz), ATG16 (Santa Cruz), β-actin (Sigma) and Flag-tag (Sigma; clone M2) were used in a 1:2,000 dilution.

Techniques: Expressing, Phospho-proteomics, Transfection, Control, Plasmid Preparation, Infection, Virus

Journal: Microbiology Spectrum

Article Title: SARS-CoV-2 Harnesses Host Translational Shutoff and Autophagy To Optimize Virus Yields: the Role of the Envelope (E) Protein

doi: 10.1128/spectrum.03707-22

Figure Lengend Snippet: Effect of γ 34.5 protein on autophagy during SARS-CoV-2 infection. (A–B) Replicate cultures of Vero E6 and doxycycline-induced Vero E6 + γ 34.5 cells were infected with either the SARS-CoV-2 USA-WA1/2020 (panel A) or the reporter virus icSARS-CoV-2-mNG (panel B) (10 −4 PFU/cell). Cells were harvested at 36 h postinfection and equal amounts of proteins were analyzed for p-eIF-2α, total eIF-2α, LC3, γ 34.5 (Flag-tagged), ATG5, Beclin-1, S, E, N protein expression, and β-actin. Numbers represent ratio of LC3-II/LC3-I (panel A) and a quantification of LC3-I and LC3-II (panel B). (C) Quantification of band intensity of p-eIF-2α versus total eIF-2α relative to uninfected, Vero E6 cells from at least three independent experiments is depicted. (D) Vero-E6 cells were transfected at 50% confluence with either a control (scrambled) siRNA (Santa Cruz; sc-37007) or Beclin 1 siRNA (Santa Cruz; sc-29797) using Lipofectamine 3000 according to manufacturer’s instructions (Invitrogen). Both siRNAs were used at a 300 nM concentration and the cells were transfected for 72 h before infection. Efficiency of Beclin-1 depletion is depicted. Vero E6 cells treated with either the scrambled siRNA, or the Beclin-1 siRNA as above were infected with icSARS-CoV-2-mNG (10 −4 PFU/cell). Images were captured at 24 h postinfection using an Olympus microscope. (E) Vero E6 cells treated with Beclin-1 and scrambled siRNA as above were infected with wild type SARS-CoV-2 (10 −4 PFU/cell). The cells were harvested at 24 h postinfection followed by total RNA extraction. Quantification of the negative-sense RNA was done by RT-qPCR analysis. (F) Vero E6, ATG16L KD and ATG5 KD derivatives were infected with icSARS-CoV-2-mNG, as above and images were captured at 24 h postinfection. (G) Infections of Vero E6 cells and ATG16L KD or ATG5 KD derivatives were performed with the wild-type SARS-CoV-2. Samples were harvested at 24 h postinfection and quantification of progeny virus production was performed by plaque assays. All values were derived after analyzing samples from three independent experiments. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (H–I) Efficiency of ATG16L or ATG5 depletion using specific shRNAs (Sigma) expressed from integrated lentiviral vectors is depicted. To deplete ATG16L four different cell lines were established using four different shRNAs ( ). The cell line expressing shRNA number 2 was selected as depletion of ATG16L was more efficient.

Article Snippet: The mouse monoclonal antibodies to HA-tag (Santa Cruz), GFP (Santa Cruz), ATG5 (Santa Cruz), ATG16 (Santa Cruz), β-actin (Sigma) and Flag-tag (Sigma; clone M2) were used in a 1:2,000 dilution.

Techniques: Infection, Virus, Expressing, Transfection, Control, Concentration Assay, Microscopy, RNA Extraction, Quantitative RT-PCR, Derivative Assay, shRNA

Journal: bioRxiv

Article Title: WRN helicase upregulates mitophagy by resolving an intricate nexus of G-quadruplexes-R loops-ATG7 pre-mRNA maturation in cancer

doi: 10.64898/2025.12.11.692796

Figure Lengend Snippet: (A) Schematic representation of the autophagy pathway, highlighting key proteins such as ATG7, ATG5, Beclin-1 and Class III PI3K complex involved in the lipidation of LC3 and formation of autophagosome. (B) Western blot analysis of autophagy-related proteins in WRN +/+ and WRN -/- cells treated with cisplatin (CDDP, 10 µM) for indicated time. Proteins probed are ATG3, Beclin-1, ATG7, ATG12, ATG5, and LC3-I/II. β-actin was used as a loading control. (C, D) Immunofluorescence of G4-DNA (red) in WRN +/+ and WRN -/- cells, co-stained with DAPI (blue). Quantification of G4-DNA foci per cell in WRN +/+ and WRN-/- cells were plotted (E) ATG7 protein expression in WRN +/+ and WRN -/- cells treated with Pyridostatin (PDS: a G4 stabilizer) for indicated time interval. Protein levels were measured by Western blotting. (F) Graphical schematic of ATG7 gene showing potential G-quadruplex-forming regions (Q1, Q2, Q3) with respect to promoter and intron/exon. (G) Chromatin immunoprecipitation with G4 antibody was performed in WRN +/+ and WRN -/- cells. G4-DNA was detected and quantified with the RT-PCR primer designed at Q1, Q2 and Q3 putative site in ATG7 gene. (H) Relative total cellular ATG7 mRNA levels in WRN +/+ and WRN -/- cells was determined by qRT-PCR. (I) Schematic model illustrating the role of U2AF35 and probable involvement of WRN in the regulation of nascent ATG7 mRNA processing. The process involves cleavage at the proximal and distal cleavage/polyadenylation (CP) sites, leading to the formation of a shorter and mature 3’-UTR for the expression of active ATG7 protein, which subsequently activates autophagy. (J) Quantification of ATG7 mRNA processing in WRN +/+ and WRN -/- cells. The fold change (FC) of distal versus proximal end ATG7 mRNA between the two cell types was analyzed and quantified. (K) WRN mutant constructs used in the study. Schematic representation of WRN +/+ and WRN mutants, highlighting the functional domains (Exonuclease, Helicase, RQC, HRDC) and the sites of mutations for generation of helicase-dead (K577M) and/or exonuclease-dead (E84A) WRN proteins. (L) ATG7 mRNA (distal and proximal) in WRN -/- cells and WRN -/- cells complemented with WRN-WT and mutant, was analyzed and quantified for the fold change of distal versus proximal end ATG7 mRNA. (M, N) Co-immunoprecipitation of FLAG-tagged-WRN with U2AF35 in WRN -/- cells. Cells were treated with cisplatin (CDDP, 10 µM) for 24 h, and lysates were immunoprecipitated using an IgG control or anti-FLAG antibody. The FLAG and U2AF35 proteins were detected by immunoblotting (IB). (N) RNA immunoprecipitation (RIP) was performed with anti-WRN antibody (WRN-Ab) or IgG antibody (IgG-Ab), and the qRT-PCR was done with ATG7 primer. Relative ATG7 mRNA levels in RNA pull down with anti-WRN antibody (WRN-Ab) or IgG antibody (IgG-Ab) treatment was plotted. All the values indicated are mean ± SEM (n = 3-4), ns denotes nonsignificant, * p <0.05, ** p < 0.01 and *** p < 0.001.

Article Snippet: Antibodies for BECN1 (#3495P), LC3A/B I/II (#12741), LC3B (#3868P), ATG5 (#12994P), ATG7 (#8558P), ATG3(#3145P), ATG12 (#4180) were procured from Cell Signaling Technology (Danvers, MA, USA).

Techniques: Western Blot, Control, Immunofluorescence, Staining, Expressing, Chromatin Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Mutagenesis, Construct, Functional Assay, Immunoprecipitation, RNA Immunoprecipitation